(DC2. Nanoparticle tracking analysis of the exosomes secreted by DC2.4 cells with and without infection. 2.3. RNA DC2.4RNARNA( 1)RNARNA 1 DC2.4RNA Number of small RNAs detected in the exosomes of DC2.4 cells with and without infection infection 17491171318991896Normal control 16061111327641613infection 262810814112902167Normal control 25032169310041816infection 362766611724153825Normal control 36554919711052348 Open in a separate window 2.4. piRNA piRNA2piRNA5piRNA ( 2) 2 piRNA Differentially expressed piRNA screened in the exosomes from DC2.4 cells with and without infection thead IDControl group Rabbit polyclonal to MCAM expressionExperimental group expressionSequence /thead piR-mmu-1590.143.30TGCAATTCAGCTTTCCTGCGGTGTTGGTGTpiR-mmu-15261.307.48TGCCCTGTCAGAACTGTGATGTCTGTGGTpiR-mmu-90820.285.05TGTGTCTGAGCTCCAACATTGTTGGTGTATTpiR-mmu-174055.2327.18TAGACACGTGAGCAACAGTAAATATGAApiR-mmu-255761686.903480.88TNGACCTAACAGGACCTCAGAGAAAACA Open in a separate window 2.5. Suvorexant inhibitor database piRNA miRandaTargetscanpiRNA3869(KDAKey Driver Analysis)Sema6aPlxna3Nrp1PxnSrcDlg4Dlgap1Notch1Acvt2aBmp8a11( 3) Open in a separate window 3 KDA Key driver analysis of the 3869 target genes showing 11 target genes Suvorexant inhibitor database at Suvorexant inhibitor database the key nodes. 2.6. piRNAKyoto Encyclopedia of Genes and Genomes (KEGG) KEGG-pathwayRphyper em P /em em P /em FDRFDR0.01( 4)MAPKRascAMPactin Open in another home Suvorexant inhibitor database window 4 KEGG-pathway Focus on gene aggregation map attained by KEGG pathway annotation classification Suvorexant inhibitor database from the 3869 focus on genes. 3.? DC2.4[10]TTDC2.4[20-22][17][18] 28 h[23]DC2.428 hDC2.4DC2.4DC2.4RNARNARNADC2.4RNA RNA[24]piRNARNApiRNA2006piRNA[25]piRNApiRNA[26]piRNA[27]piRNADC2.4piRNApiRNA [28]DC2.4miRNApiRNApiRNA- Biography ?? E-mail: moc.qq@391212075 Financing Statement (815720128177221720182800681971954)(2017YFD0500400)(2016A0303110252017A030313694)(2018A050506038)(201904020011) Backed by National Normal Research Foundation of China (81572012, 81772217, 201828006, 81971954).