Alzheimer’s disease (AD) is the most common form of neurodegeneration and the major cause of dementia. during and following the experimental treatments behavioural tests were performed with these transgenic mice and their naive littermates. Following relatively short-term treatments of 10?days brain tissue of mice were removed for immunohistochemical assays. The results indicate that both oral treatment and injection of Oridonin significantly attenuated β-amyloid deposition plaque-associated APP expression and microglial activation in brain of transgenic mice. Furthermore injection of Oridonin-nanoemulsion ameliorated deficits in nesting an important affiliative behaviour CP-690550 and in interpersonal interaction. Additional studies indicated that Oridonin effectively attenuated inflammatory reaction of macrophage and microglial cell lines. Our results suggest that Oridonin might be considered a encouraging therapeutic option for human AD or other neurodegenerative diseases. and biological activities 6. Further studies also suggested potential therapeutic application of diterpenoids for neurogenerative disorders 7 CP-690550 8 Oridonin a natural diterpenoid compound (Fig.?1) 10 isolated from Chinese plant Rabdosia rubescens exhibits a variety of biological properties: anti-bacterial oxygen free-radical scavenging anti-mutagenic and remarkable anti-neoplastic activities 11-12. Recently anti-neuroinflammatory and neuroregulatory effects have been reported or suggested by several CP-690550 CP-690550 studies 13 14 which may suggest its potential application against neuroinflammatory and neurodegenerative disorders. Physique 1 Molecular structure of Oridonin. In this study we used a APP/PS1-21 double transgenic mouse model on a C57BL/6J genetic background that co-expresses the KM670/671NL mutated human amyloid precursor protein and the Rabbit Polyclonal to USP32. L166P mutated human presenilin 1 (APP/PS1-21 mice). This mouse model exhibits very aggressive AD pathology accompanied by neuroinflammation and impairment of cognitive function 16-17. Our aim here was to study potential therapeutic effect of Oridonin on this APP/PS1 mouse model. Materials and methods Animals Male APP/PS1-21 mice were obtained from Prof. Jucker (Hertie-Institute Tuebingen Germany). Heterozygous male APP/PS1-21 mice were bred with wild-type C57BL/6J females (Charles River Germany Sulzfeld Germany). Offspring were tail snipped and genotyped using PCR with primers specific for the APP-sequence (Forward: CP-690550 “GAATTCCGACATGACTCAGG” Reverse: “GTTCTGCTGCATCTTGGACA”). All experiments were licensed according to the The German Animal Welfare Take action (TierSchG) of 2006. Materials Oridonin (>99%) was purchased from Carbosynth Ltd. (Compton Berkshire UK). For oral treatment Oridonin was suspended in 1% carboxymethylcellulose (CMC Blanose? Hercules-Aqualon Düsseldorf Germany) at a concentration of 2?mg/ml. For injection Oridonin was loaded with a nanostructured carrier Lipofundin? (MCT 10 for infusion B. Braun AG Melsungen Germany) by high pressure at a concentration ratio of 2?mg/ml. A quantity of 30?mg Oridonin was first coarsely dispersed in 60?ml Lipofundin. Subsequently the dispersion was high-pressure homogenized using an Emulsiflex C3 (Avestin Inc. Canada). At first five cycles at 750?bar and then five cycles at 1750?bar were run yielding ～50?ml of a 2?mg/ml formulation. Treatment with Oridonin Six groups of animals (assays The immortalized murine macrophage cell collection RAW 264.7 and microglia cell collection N9 were used to determine effects of Oridonin on inflammatory reaction of macrophages and microglia using murine macrophage cell collection RAW 264.7 and murine microglia cell collection N9 were studied. Inflammatory macrophage activation was induced by LPS (1?μg/ml); with or without Oridonin treatment for 24 and 48?hrs. Following LPS induction significantly increased nitric oxide production and mRNA expression of iNOS IL-1β and IL-6 indicated an inflammatory activation. Oridonin significantly reduced CP-690550 the nitric oxide concentration and attenuated mRNA expression of iNOS IL-1β and IL-6 suggesting an effective anti-inflammatory activity of Oridonin for both macrophage and microglia cell lines. Oridonin experienced very similar effects for N9 and RAW cell cultures results from N9 cell culture are shown in the Physique?7. In addition cell viability during treatments was confirmed by MTT assay and morphology analysis (data not shown). Physique 7.